Product Name : JBC3-00201
Species name : Capnocytophaga granulosa strain: JCM 8564(99.83%)/Capnocytophaga granulosa strain KCOM 3394 (=ChDC P012-Td2)(99.65%)
Species/Strain : Species
Phylum : Bacteroidetes
Sequence :CTCGTTGTAGGACTTAACCTGACACCTCACGGCACGAGCTGACGACAACCATGCAGCACCTTGAAAACTGTCCGAAGAAAAAGGCATCTCTGCCCCTGTCAGTCTCCATTTAAACCTTGGTAAGGTTCCTCGCGTATCATCGAATTAAACCACATGCTCCACCGCTTGTGCGGGCCCCCGTCAATTCCTTTGAGTTTCACACTTGCGTGCGTACTCCCCAGGTGGGATACTTATCACTTTCGCTTAGCCACTCAAATTACTCCAAACAGCTAGTATCCATCGTTTACAGCGTGGACTACCAGGGTATCTAATCCTGTTCGCTCCCCACGCTTTCGTCTCTCAGCGTCAATCGTCTGTTAGTCCCCTGCCTCCGCAATCGGTGTTCTGTGTAATATCTAAGCATTTCACCGCTACACTACACATTCCAAGAACTTCACAGATATTCAAGACTACCAGTATCAAAGGCAATTTCTCAGTTAAGCTGAAACCTTTCACCTCTGACTTAATAGCCCGCCTACAGACCCTTTAAACCCAATGATTCCGAATAACGCTCGCATCCTCCGTATTACCGCGGGG

JBC3-00201

$400.00Price