Product Name : JBC2-00401
Species name : [Candida] membranifaciens culture CBS:1952/[Candida] membranifaciens culture CBS:2875(100%)
Species/Strain : Species
Phylum : Ascomycota
Sequence :AAACCTAATACATTGAATAACCAGTTCGTACTATCCAGTACACTCCTGCCATTATATTTGAAGCAAACACTTAGTTGACTAAGAGTATCACTCAACACCAAACCCAAAGGTTTGAAGGAGAAATGACGCTCAAACAGGCATGCCCTTTGGAATACCAAAGGGCGCAATGTGCGTTCAAAGATTCGATGATTCACGAAAATCTGCAATTCATATTACTTATCGCATTTCGCTGCGTTCTTCATCGATGCGAGAACCAAGAGATCCGTTGTTGAAAGTTTTGAAGATTATTTTGAAATTAATCAAACAAAATTGACAATAAAAATTTAAAACAATTCAATTTCGCAATTGAAGTTTGTGTAAGTCTTTGGCCCAGCTTTCGCCAAACCAAAGCAAGTTTTCAATAAAACAAAAACACAGTGTGTAAGGTGTTTGCTTGTCGCCGCGCAATTAAGCGCAGGCAACAAACTAAAACTATCAGTAATGATCCTTCCGCAGGTTCACCTACGGAAACCTTGTTACGA

JBC2-00401

$400.00Price