Product Name : JBC2-00301
Species name : [Candida] glabrata strain CBS 138 /[Candida] glabrata strain ATCC 2001(100%)
Species/Strain : Species
Phylum : Ascomycota
Sequence :TAAGTGCGCGGTTGGTGGGTGTTCTGCAGTGGGGGGAGGGAGCCGACAAAGACCTGGGAGTGTGCGTGGATCTCTCTATTCCAAAGGAGGTGTTTTATCACACGACTCGACACTTTCTAATTACTACACACAGTGGAGTTTACTTTACTACTATTCTTTTGTTCGTTGGGGGAACGCTCTCTTTCGGGGGGGAGTTCTCCCAGTGGATGCAAACACAAACAAATATTTTTTTAAACTAATTCAGTCAACACAAGATTTCTTTTAGTAGAAAACAACTTCAAAACTTTCAACAATGGATCTCTTGGTTCTCGCATCGATGAAGAACGCAGCGAAATGCGATACGTAATGTGAATTGCAGAATTCCGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTCTGGTATTCCGGGGGGCATGCCTGTTTGAGCGTCATTTCCTTCTCAAACACATTGTGTTTGGTAGTGAGTGATACTCGTTTTTGAGTTAACTTGAAATTGTAGGCCATATCAGTATGTGGGACACGAGCGCAAGCTTCTCTATTAATCTGCTGCTCGTTTGCGCGAGCGGCGGGGGTTAATACTGTATTAGGTTTTACCAACTCGGTGTTGATCTAGGGAGGGATAAGTGAGTGTTTTGTGCGTGCTGGGCAGACAGACGTCTTTAAGTTTGACCTCAAATCAGGTAGGGTTACCCGCTGAACTTAA

JBC2-00301

$400.00Price