Product Name : JBC12-04601
Species name : [Clostridium] innocuum strain LC-LUMC-CI-001/[Clostridium] innocuum strain I46(91.58%)
Species/Strain : Species
Phylum : Fermicutes
Sequence :CTCGTTGTTGGTACGGCGTTTGGTAAGGTTCGTAAAATGACAGATGATCACGGCCGTGAAATCAAGAAGGCACTGCCTTCCACACCGGTGGAAATTATCGGTCTGAATGATGTACCGATTGCTGGTGATATCTTTAAGGCTTTCGATAATGAAAAGAAGGCACGTCAGATTGCGGAAACGCGTCTGAACAATAAAATTGCTTCCGAGCGCAATGCGACCGGAGCTGCGATGTCTCTGGATGATCTGGCACGCCAGATTGAAGAAGGAGAAGTGCAGGAGGTCAACCTGATTATCAAGGCGGATGTTCAGGGTAGTGCGGAAGCAGTTCGTGCAAGCATGGAAAAAATCGATGTACAGGGCGTGCGTGTCAATGTCATCCGCTCCCAGGCAGGAGCTATCACAGAATCTGATATTCTGCTGGCAAGTGCATCCCATGCCGTGATTTACGGCTTCAACGTACGTCCAAACGCACTGGTACGTAAAAAAGCAGAAGAGGAAGGCATTGAAATCCGTCTGCACAATATTATTTATAAGGCATTGGAAGAAATGGAAAATGCCATGAAAGGTATGCTGGCCCCTGTATATGAGGAAGTCGTTATCGGACAGGCAGA

JBC12-04601

$400.00Price