Product Name : JBC12-01001
Species name : Clostridium citroniae strain DSM 19261/Uncultured bacterium clone 16slp85-11d05.p1k(98.12%)
Species/Strain : Species
Phylum : Fermicutes
Sequence :AGCGTAGACGGCGAAGCAAGTCTGGAGTGAAAACCCAGGGCTCAACCCTGGGACTGCTTTGGAAACTGTTTTGCTAGAGTGTCGGAGAGGTAAGTGGAATTCCTAGTGTAGCGGTGAAATGCGTAGATATTAGGAGGAACACCAGTGGCGAAGGCGGCTTACTGGACGATAACTGACGTTGAGGCTCGAAAGCGTGGGGAGCAAACAGGATTAGATACCCTGGTAGTCCACGCCGTAAACGATGAATGCTAGGTGTTGGGGGGCAAAGCCCTTCGGTGCCGTCGCAAACGCAATAAGCATTCCACCTGGGGAGTACGTTCGCCAGAATGAAACTCAAAGGAATTGTCGGGGACCCCCACAAGCGGTGGAGCATGTGGTTTAATTCTAAGCACCGCGAAGAACCTTACCACGTCTTGTCATCTCCC

JBC12-01001

$400.00Price