Product Name : JBC12-00901
Species name : [Clostridium] celerecrescens strain DSM 105336/[Clostridium] celerecrescens strain CAU 1557(99.43%)
Species/Strain : Species
Phylum : Fermicutes
Sequence :GCGTAGACGGCACTGCAAGTCTGGAGTGAAAGCCCGGGGCTCAACCCCGGGACTGCTTTGGAAACTGTGGTGCTAGAGTGCAGGAGAGGTAAGTGGAATTCCTAGTGTAGCGGTGAAATGCGTAGATATTAGGAGGAACACCAGTGGCGAAGGCGGCTTACTGGACTGTAACTGACGTTGAGGCTCGAAAGCGTGGGGAGCAAACAGGATTAGATACCCTGGTAGTCCACGCCGTAAACGATGAATACTAGGTGTTGGGGAGCAAAGCTCTTCGGTGCCGCCGCTAACGCAATAAGTATTCCACCTGGGGAGTACGTTCGCAAGAATGAAACTCAAAGGAATTGACGGGGACCCGCACAAGCGGTGGAGCATGTGGTTTAATTCGAAGCAACGCGAAGAACCTTACCAAGTCTTGACATCGGAATGACCGGGATGTAACGATCCCTTCCCTTCGGGGCATTCCAAACAGGTGGTGCATGGTTGTCGTCACCTCGTGTCGTGAAATGTTGGGTTAAGTCCCGCAACGAG

JBC12-00901

$400.00Price