Product Name : JBC12-00801
Species name : Clostridium celatum , strain: JCM 1394/Uncultured bacterium clone 250_InIs3-A7(98.40%)
Species/Strain : Species
Phylum : Fermicutes
Sequence :GGNCANCCTATCATGCAGTTCGAGCGATTGGATTTCCTTCGGGATTGAAGCTAGCGGCGGACGGGTGAGTAACACGTGGGCAACCTGCCTCATAGAGGGGAATAGCCTCCCGAAAGGGAGATTAATACCGCATAAGATTGTAGCTTCGCATGAAGTAGCAATTAAAGGAGNAATCCGCTATGAGATGGGCCCGCGGCGCATTAGCTAGTTGGTGAGGTAACGGCTCACCAAGGCGACNATGCGTAGCCGACCTGAGAGGGTGATCGGCCACATTGGGACTGAGACACGGCCCAGACTCCTACGGGAGGCAGCAGTGGGGAATATTGCACAATGGGGGAAACCCTGATGCAGCAACGCCGCGTGAGTGATGACGGCCTTCGGGTTGTAAAGCTCTGTCTTCAGGGACGATAATGACGGTACCTGAGGAGGAAGCCACGGCTAACTACGTGCCANCANCCGCGGTAATACGTANGTGGCGAGCGTTGTCCGGATTTACTGGGCGTAAAGGGA

JBC12-00801

$400.00Price