Product Name : JBC11-00606
Species name : Citrobacter sp. strain S1/Citrobacter freundii complex strain ABFQG(99.39%)
Species/Strain : Species
Phylum : Proteobacteria
Sequence :TGCATGTCGAGCGGCAGCGGGAAAGTAGCTTGCTACTTTTGCCGGCGAGCGGCGGACGGGTGAGTAATGCCTGGGAAATTGCCCAGTCGAGGGGGATAACAGTTGGAAACGACTGCTAATACCGCATACGCCCTACGGGGGAAAGCAGGGGACCTTCGGGCCTTGCGCGATTGGATATGCCCAGGTGGGATTAGCTAGTTGGTGAGGTAATGGCTCACCAAGGCGACGATCCCTAGCTGGTCTGAGAGGATGATCAGCCACACTGGAACTGAGACACGGTCCAGACTCCTACGGGAGGCAGCAGTGGGGAATATTGCACAATGGGGGAAACCCTGATGCAGCCATGCCGCGTGTGTGAAGAAGGCCTTCGGGTTGTAAAGCACTTTCAGCGAGGAGGAAAGGTTGATGCCTAATACGTATCAACTGTGACGTTACTCGCAGAAGAAGCACCGGCTAACTCCGTGCCAGCAGCCGCGGTAATACGGAGGGTGCAAGCGTTAATCGGAATTACTGGGCGTAAAGCGCACGCAGGCGGTTGGATAAGTTAGATGTGAAAGCCCCGGGCTCAACCTGGGAATTGCATTTAAAACTGTCCAGCTAGAGTCTTGTAGAGGGGGGTAGAATTCCAGGTGTAGCGGTGAAATGCGTAGAGATCTGGAGGAATACCGGTGGCGAAGGCGGCCCCCTGGACAAAGACTGACGCTCAGGTGCGAAAGCGTGGGGAGCAAACAGGATTAGATACCCTGGTAGTCCACGCCGTAAACGATGTCGATTTGGAGGCTGTGTCCTTGAGACGTGGCTTCCGGAGCTAACGCGTTAAATCGACCGCCTGGGGAGTACGGCCGCAAGGTTAAAACTCAAATGAATTGACGGGGGCCCGCACAAGCGGTGGGA

JBC11-00606

$400.00Price