Product Name : JBC11-00201
Species name : Citrobacter sedlakii strain CIP 105037/Citrobacter sp. strain RR7(100%)
Species/Strain : Species
Phylum : Proteobacteria
Sequence :AGGAAGCAGCTTGCTGCTTCGCTGACGAGTGGCGGACGGGTGAGTAATGTCTGGGAAACTGCCCGGTGGAGGGGGATAACTACTGGAAACGGTAGCTAATACCGCATAACGTCGCAAGACCAAAGAGGGGGACCTTCGGGCCTCTTGCCACCGGATGTGCCCAGATGGGATTAGCTTGTTGGTGAGGTAACGGCTCACCAAGGCGACGATCCCTAGCTGGTCTGAGAGGATGACCAGCCACACTGGAACTGAGACACGGTCCAGACTCCTACGGGAGGCAGCAGTGGGGAATATTGCACAATGGGCGCAAGCCTGATGCAGCCATGCCGCGTGTATGAAGAAGGCCTTCGGGTTGTAAAGTACTTTCAGCGGGGAGGAAGGGATTGTGGTTAATAACCACAGTCATTGACGTTACCCGCAGAAGAAGCACCGGCTAACTCCGTGCCAGCAGCCGCGGTAATACGGAGGGTGCAAGCGTTAATCGGAATTACTGGGCGTAAAGCGCACGCAGGCGGTCTGTCAAGTCGGATGTGAAATCCCCGGGCTCAACCTGGGAACTGCATTCGAAACTGGCAGGCTTGAGTCTCGTAGAGGGGGGTAGAATTCCAGGTGTAGCGGTGAAATGCGTAGAGATCTGGA

JBC11-00201

$400.00Price