Product Name : JBS8-00101
Species name : Shigella boydii strain P288 / Escherichia fergusonii ATCC 35469(100%)
Species/Strain : Strain
Phylum : Proteobacteria
Sequence :CCGCTCGTTGCGGGACTTAACCCAACATTTCACAACACGAGCTGACGACAGCCATGCAGC ACCTGTCTCACGGTTCCCGAAGGCACATTCTCATCTCTGAAAACTTCCGTGGATGTCAAGACCAGGTAAGGTTCTTCGCGTTGCATCGAATTAAACCACATGCTCCACCGCTTGTGCGGGCCCCCGTCAATTCATTTGAGTTTTAACCTTGCGGCCGTACTCCCCAGGCGGTCGACTTAACGCGTTAGCTCCGGAAGCCACGCCTCAAGGGCACAACCTCCAAGTCGACATCGTTTACGGCGTGGACTACCAGGGTATCTAATCCTGTTTGCTCCCCACGCTTTCGCACCTGAGCGTCAGTCTTCGTCCAGGGGGCCGCCTTCGCCACCGGTATTCCTCCAGATCTCTACGCATTTCACCGCTACACCTGGAATTCTACCCCCCTCTACGAGACTCAAGCTTGCCAGTATCAGATGCAGTTCCCAGGTTGAGCCCGGGGATTTCACATCTGACTTAACAAACCGCCTGCGTGCGCTTTACGCCCAGTAATTCCGATTAACGCTTGCACCCTCCGTATTACCGCGGTG

JBS8-00101

$400.00Price