Product Name : JBP14-00103
Species name : Proteus mirabilis strain G137/Proteus mirabilis strain IK-MB4-518F (99.82%)
Species/Strain : Strain
Phylum : Proteobacteria
Sequence :TTATCGGATTACTGGGCGTAAGCGCACGCAGGCGGTCAATTAAGTCAGATGTGAAAGCCCCGAGCTTAACTTGGGAATTGCATCTGAAACTGGTTGGCTAGAGTCTTGTAGAGGGGGGTAGAATTCCACGTGTAGCGGTGAAATGCGTAGAGATGTGGAGGAATACCGGTGGCGAAGGCGGCCCCCTGGACAAAGACTGACGCTCAGGTGCGAAAGCGTGGGGAGCAAACAGGATTAGATACCCTGGTAGTCCACGCTGTAAACGATGTCGATTTAGAGGTTGTGGTCTTGAACCGTGGCTTCTGGAGCTAACGCGTTAAATCGACCGCCTGGGGAGTACGGCCGCAAGGTTAAAACTCAAATGAATTGACGGGGGCCCGCACAAGCGGTGGAGCATGTGGTTTAATTCGATGCAACGCGAAGAACCTTACCTACTCTTGACATCCAGCGAATCCTTTAGAGATAGAGGAGTGCCTTCGGGAACGCTGAGACAGGTGCTGCATGGCTGTCGTCAGCTCGTGTTGTGAAATGTTGGGTTAAGTCCCGCAACGGGGCCCA

JBP14-00103

$400.00Price