Product Name : JBA2-00402
Species name : Achromobacter sp. strain T5712/Achromobacter insuavis strain JKP12(99.69%)
Species/Strain : Species
Phylum : Proteobacteria
Sequence :GTGGATGTCAAGACCAGGTAAGGTTCTTCGCGTTGCATCGAATTAAACCACATGCTCCACCGCTTGTGCGGGCCCCCGTCAATTCATTTGAGTTTTAACCTTGCGGCCGTACTCCCCAGGCGGTCGACTTAACGCGTTAGCTCCGGAAGCCACGCCTCAAGGGCACAACCTCCAAGTCGACATCGTTTACGGCGTGGACTACCAGGGTATCTAATCCTGTTTGCTCCCCACGCTTTCGCACCTGAGCGTCAGTCTTCGTCCAGGGGGCCGCCTTCGCCACCGGTATTCCTCCAGATCTCTACGCATTTCACCGCTACACCTGGAATTCTACCCCCCTCTACGAGACTCAAGCTTGCCAGTATCAGATGCAGTTCCCAGGTTGAGCCCGGGGATTTCACATCTGACTTAACAAACCGCCTGCGTGCGCTTTACGCCCAGTAATTCCGATTAACGCTTGCACCCTCCGTATTACCGCGGCTGCTGGCACGGAGTTAGCCGGTGCTTCTTCTGCGGGTAACGTCAATGAGCAAAGGTATTAACTTTACTCCCTTCCTCCCCGCTGAAAGTACTTTACAACCCGAAGGCCTTCTTCATACACGCGGCATGGCTGCATCAGGCTTGCGCCCATTGTGCAATATTCCCCACTGCTGCCTCCCGTAGGAGTCTGGACCGTGTCTCAGTTCCAGTGTGGCTGGTCATCCTCTCAGACCAGCTAGGGATCGTCGCC

JBA2-00402

$400.00Price