Product Name : JBB4-002204
Species name : Bacteroides thetaiotaomicron strain MAME-1/Bacteroides thetaiotaomicron, strain DH4111(99.88%)
Species/Strain : Strain
Phylum : Bacteroidetes
Sequence :GACGACACCATGCAGCACCTTCACATTTGCCTTGCGGCTAACCTGTTTCCAGATTATTCAAATGCAATTTAAGCCCGGGTAAGGTTCCTCGCGTATCATCGAATTAAACCACATGTTCCTCCGCTTGTGCGGGCCCCCGTCAATTCCTTTGAGTTTCACCGTTGCCGGCGTACTCCCCAGGTGGAATACTTAATGCTTTCGCTTGGCCGCTTACTGTATATCGCAAACAGCGAGTATTCATCGTTTACTGTGTGGACTACCAGGGTATCTAATCCTGTTTGATACCCACACTTTCGAGCATCAGTGTCAGTTGCAGTCCAGTGAGCTGCCTTCGCAATCGGAGTTCTTCGTGATATCTAAGCATTTCACCGCTACACCACGAATTCCGCCCACCTCTACTGTACTCAAGACAGCCAGTATCAACTGCAATTTTACGGTTGAGCCGCAAACTTTCACAACTGACTTAACTGTCCACCTACGCTCCCTTTAAACCCAATAAATCCGGATAACGCTCGGATCCTCCGTATTACCGCGGCTGCTGGCACGGAGTTAGCCGATCCTTATTCATATGGTACATACAAAATTCCACACGTGGAAAACTTTATTCCCATATAAAAGAAGTTTACAACCCATAGGGCAGTCATCCTTCACGCTACTTGGCTGGTTCAGGCCTGCGCCCATTGACCAATATTCCTCACTGCTGCCTCCCGTAGGAGTTTGGACCGTGTCTCAGTTCCAATGTGGGGGACCTTCCTCTCAGAACCCCTATCCATCGAAGGTTTGGTGAGCCGTTACCTCACCAAC

JBB4-002204

$400.00Price