Product Name : JBP16-00808
Species name : Pseudomonas stutzeri strain XQ-3/Pseudomonas putida strain BBAL5-01(99%)
Species/Strain : Species
Phylum : Proteobacteria
Sequence :TTATCGGATTACTGGGCGTAAGCGCACGCAGGCGGTCAATTAAGTCAGATGTGAAAGCCCCGAGCTTAACTTGGGAATTGCATCTGAAACTGGTTGGCTAGAGTCTTGTAGAGGGGGGTAGAATTCCACGTGTAGCGGTGAAATGCGTAGAGATGTGGAGGAATACCGGTGGCGAAGGCGGCCCCCTGGACAAAGACTGACGCTCAGGTGCGAAAGCGTGGGGAGCAAACAGGATTAGATACCCTGGTAGTCCACGCTGTAAACGATGTCGATTTAGAGGTTGTGGTCTTGAACCGTGGCTTCTGGAGCTAACGCGTTAAATCGACCGCCTGGGGAGTACGGCCGCAAGGTTAAAACTCAAATGAATTGACGGGGGCCCGCACAAGCGGTGGAGCATGTGGTTTAATTCGATGCAACGCGAAGAACCTTACCTACTCTTGACATCCAGCGAATCCTTTAGAGATAGAGGAGTGCCTTCGGGAACGCTGAGACAGGTGCTGCATGGCTGTCGTCAGCTCGTGTTGTGAAATGTTGGGTTAAGTCCCGCAACGGGGCCCA

JBP16-00808

$400.00Price