Product Name : JBB4-02601
Species name : Bacteroides koreensis strain YS-aM39 /Bacteroides kribbi strain ZN-GAM-D3-86(100%)
Species/Strain : Species
Phylum : Bacteroidetes
Sequence :GTCGGGTTGCAGACTTCGATCCGAACTGAGAGAGGTTTTTGGGATTAGCATCCTGTCACCAGGTAGCCGCCTTCTGTACCCCCCATTGTAACACGTGTGTAGCCCCGGACGTAAGGGCCGTGCTGATTTGACGTCATCCCCACCTTCCTCACATCTTACGACGGCAGTCTCTCTAGAGTCCTCAGCATGACCTGTTAGTAACTAAAGATAAGGGTTGCGCTCGTTATGGCACTTAAGCCGACACCTCACGGCACGAGCTGACGACAACCATGCAGCACCTTCACAACAGCCTTACGGCTATACTGTTTCCAATATATTCTGTTGCAATTTAAGCCCGGGTAAGGTTCCTCGCGTATCATCGAATTAAACCACATGTTCCTCCGCTTGTGCGGGCCCCCGTCAATTCCTTTGAGTTTCACCGTTGCCGGCGTACTCCCCAGGTGGAATACTTAATGCTTTCGCTTGGCCGCTTACTGTATATCGCAAACAGCGAGTATTCATCGTTTACTGTGTGGACTACCAGGGTATCTAATCCTGTTTGATACCCACACTTTCGAGCATCAGTGTCAGTGACAGTCTAGTGAGCTGCCTTCGCAATCGGAGTTCTTCGTGATATCTAAGCATTTCACCGCTACACCACGAATTCCGCCCACCTCTACTGTACTCAAGACTGCCAGTTTCAACTGCAATTTTACGGTTGAGCCGCAAACTTTCACAACTGACTTAACAATCCACCTACGCTCCCTTTAAACCCAATAAATCCGGATAACGCTCGGATCCTCCGTATTACCGCGGCTGCTGGCACGGAGTTAGCCGATCCTTATTCATATGGTACATACAAAATTCCACACGTGGAAAACTTTATTCCCATATAAAAGAAGTTTACGACCCATAGAGCCTTCATCCTTCACGCTACTTGGCTGGTTCAGGCTCTCGCCCATTGACCAATATTCCTCACTGCTGCCTCCCGTAGGAGTTTGGACCGTGTCTCAGTTCCAATGTGGGGGACCTTCCTCTCAGAACCCCTATCCATCGTAGTCTTGGTGGGCCGTTACCCCGCCAACAAACTAATGGAACGCATCCCCATCGATAACCGAAATTCTTTAATAAAAATATCATGCGATATTCGTATGCTATCCGGTATTAATCTTTCTTTCGAAAGGCTATTCCGGAGTTATCGGCAGGTTGGATACGTGTTACTCACCCGTGCGCCGGTCGCCATCTTCAGTTTGCAAGCAAACTAAAATGCTGCCCCTCGACTG

JBB4-02601

$400.00Price