Product Name : JBB4-01601
Species name : Bacteroides oleiciplenus YIT 12058 strain JCM 16102/Bacteroides oleiciplenus YIT 12058(99.45%)
Species/Strain : Species
Phylum : Bacteroidetes
Sequence :CGTATCGGATTTATTGGGTTTAAGGGAGCGTAGGCGGAAGCTTAAGTCAGTTGTGAAAGTTTGCGGCTCAACCGTAAAATTGCAGTTGATACTGGGTTTCTTGAGTGCAGTAGAGGTAGGCGGAATTCGTGGTGTAGCGGTGAAATGCTTAGATATCACGAAGAACTCCGATTGCGAAGGCAGCTTACTGGACTGTAACTGACGCTGATGCTCGAAAGTGTGGGTATCAAACAGGATTAGATACCCTGGTAGTCCACACAGTAAACGATGAATACTCGCTGTTTGCGATATACAGCAAGCGGCCAAGCGAAAGCATTAAGTATTCCACCTGGGGAGTACGCCGGCAACGGTGAAACTCAAAGGAATTGACGGGGGCCCGCACAAGCGGAGGAACATGTGGTTTAATTCGATGATACGCGAGGAACCTTACCCGGGCTTAAATTGCAACTGACGTAGGTGGAAACATCTATTCCTTCGGGCAGTTGTGAAGGTGCTGCATGGTTGTCGTCAGCTCGTGCCGTGAGGTGTCGGCTTAAGTGCCACAACGGGCCCCAA

JBB4-01601

$400.00Price