Product Name : JBB4-01501
Species name : Bacteroides intestinalis strain 341/Bacteroides intestinalis (97.29%)
Species/Strain : Species
Phylum : Bacteroidetes
Sequence :GGCAGCATGACCTAGCAATAGGTTGATGGCGACCGGCGCACGGGTGAGTAACACGTATCCAACCTGCCGATTATTCCGGGATAGCCTTTCGAAAGAAAGATTAATACTGGATAGCATAACGAGAAGGCATCTTCTTGTTATTAAAGAATTTCGATAATCGATGGGGATGCGTTCCATTAGTTTGTTGGCGGGGTAACGGCCCACCAAGACATCGATGGATAGGGGTTCTGAGAGGAAGGTCCCCCACATTGGAACTGAGACACGGTCCAAACTCCTACGGGAGGCAGCAGTGAGGAATATTGGTCAATGGACGAGAGTCTGAACCAGCCAAGTAGCGTGAAGGATGACTGCCCTATGGGTTGTAAACTTCTTTTATATGGGAATAAAGTGAGCCACGTGTGGCTTTTTGTATGTACCATACGAATAAGGATCGGCTAACTCCGTGCCAGCAGCCGCGGTAATACGGAGGATCCGAGCGTTATCCGGATTTATTGGGTTTAAAGGGAGCGTAGGCGGATTATTAAGTCAGTTGTGAAAGTTTGCGGCTCAACCGTAAAATTGCAGTTGATACTGGTAGTCTTGAGTGCAGCAGAGGTAGGCGGAATTCGTGGTGTAGCGGTGAAATGCTTAGATATCACGAAGAACTCCGATTGCGAAGGCAGCTTACTGGACTGTAACTGACGCTGATGCTCGAAAGTGTGGGTATCAAACAGGATTAGATACCCTGGTAGTCCACACAGTAAACGATGAATACTCGCTGTTTGCGATATACAGCAAGCGGCCAAGCGAAAGCATTAAGTATTCCACCTGGGGGAGTACGCCGGCAACGGTGAAACTCAAAGGAATTGACGGGGGGCCCGCACAAGCGGGAGGAACATGTGGGTTTAATTCGATGATACGCGAAGGAACCTTACCCGGGGCTTAAATTGCAACTGAACGGATTTGGAAAACAGATCTTCCCTTCGGGCCGTTTGTGAAAGGTGCCTGCATGGGTTGTCGTCAGCCTCGTGCCCGTGAAGGTGTCGGGCTTAAGTGCCCATAACGAAGCGCCAACCCTTTATCTTTTAGTTTACTTAACAGGGTCATGGCTGAAGGAACTCTAGAAGA

JBB4-01501

$400.00Price