Product Name : JBB4-00701
Species name : Bacteroides coprophilus strain CB42(100%)/Uncultured bacterium clone 8-1H1 (99.86%)
Species/Strain : Species
Phylum : Bacteroidetes
Sequence :CGAGGGGCAGCGGGATTGAAGCTTGCTTCAATTGCCGGCGACCGGCGCACGGGTGAGTAACGCGTATCCAACCTTCCGCTTACTCGGGGATAGCCTTTCGAAAGAAAGATTAATACCCGATGGTATCTTAAGCACGCATGAGATTAAGATTAAAGATTTATCGGTAAGCGATGGGGATGCGTTCCATTAGGCAGTTGGCGGGGTAACGGCCCACCAAACCTACGATGGATAGGGGTTCTGAGAGGAAGGTCCCCCACATTGGAACTGAGACACGGTCCAAACTCCTACGGGAGGCAGCAGTGAGGAATATTGGTCAATGGGCGAGAGCCTGAACCAGCCAAGTAGCGTGAAGGATGACGGCCCTACGGGTTGTAAACTTCTTTTGTGCGGGAATAAAGGAACCTACGTGTAGGTTTTTGCATGTACCGTAACGAATAAGCATCGGCTAACTCCGTGCCAGCAGCCGCGGTAATACGGAGGATGCGAGCGTTATCCGGATTTATTGGGTTTAAAGGGAGCGTAGACGGGTTTTTAAGTCAGCTGTGAAAGTTTGGGGCTCAACCTTAAAATTGCAGTTGAAACTGGAGACCTTGAGTACGGTTGAGGCAGGCGGAATTCGTGGTGTAGCGGTGAAATGCTTAGATATCACGAAGAACCCCGATTGCGAAGGCAGCCTGCTAAGCCGCCACTGACGTTGAGGCTCGAAAGTGCGGGTATC

JBB4-00701

$400.00Price