Product Name : JBA7-00905
Species name : Aeromonas sp. 1805/Aeromonas sp. 2692-1(99.89%)
Species/Strain : Strain
Phylum : Proteobacteria
Sequence :TGCATGTCGAGCGGCAGCGGGAAAGTAGCTTGCTACTTTTGCCGGCGAGCGGCGGACGGGTGAGTAATGCCTGGGAAATTGCCCAGTCGAGGGGGATAACAGTTGGAAACGACTGCTAATACCGCATACGCCCTACGGGGGAAAGCAGGGGACCTTCGGGCCTTGCGCGATTGGATATGCCCAGGTGGGATTAGCTAGTTGGTGAGGTAATGGCTCACCAAGGCGACGATCCCTAGCTGGTCTGAGAGGATGATCAGCCACACTGGAACTGAGACACGGTCCAGACTCCTACGGGAGGCAGCAGTGGGGAATATTGCACAATGGGGGAAACCCTGATGCAGCCATGCCGCGTGTGTGAAGAAGGCCTTCGGGTTGTAAAGCACTTTCAGCGAGGAGGAAAGGTTGATGCCTAATACGTATCAACTGTGACGTTACTCGCAGAAGAAGCACCGGCTAACTCCGTGCCAGCAGCCGCGGTAATACGGAGGGTGCAAGCGTTAATCGGAATTACTGGGCGTAAAGCGCACGCAGGCGGTTGGATAAGTTAGATGTGAAAGCCCCGGGCTCAACCTGGGAATTGCATTTAAAACTGTCCAGCTAGAGTCTTGTAGAGGGGGGTAGAATTCCAGGTGTAGCGGTGAAATGCGTAGAGATCTGGAGGAATACCGGTGGCGAAGGCGGCCCCCTGGACAAAGACTGACGCTCAGGTGCGAAAGCGTGGGGAGCAAACAGGATTAGATACCCTGGTAGTCCACGCCGTAAACGATGTCGATTTGGAGGCTGTGTCCTTGAGACGTGGCTTCCGGAGCTAACGCGTTAAATCGACCGCCTGGGGAGTACGGCCGCAAGGTTAAAACTCAAATGAATTGACGGGGGCCCGCACAAGCGGTGGGA

JBA7-00905

$400.00Price