Product Name : JBA25-00101
Species name : Agrobacterium fabrum strain cqsD1/Rhizobium sp. strain BD1(100%)
Species/Strain : Species
Phylum : Proteobacteria
Sequence :CTGACGACAGCCATGCAGCACCTGTTCTGGGGCCAGCCTAACTGAAGGACATCGTCTCCAATGCCCATACCCCGAATGTCAAGAGCTGGTAAGGTTCTGCGCGTTGCTTCGAATTAAACCACATGCTCCACCGCTTGTGCGGGCCCCCGTCAATTCCTTTGAGTTTTAATCTTGCGACCGTACTCCCCAGGCGGAATGTTTAATGCGTTAGCTGCGCCACCGAACAGTATACTGCCCGACGGCTAACATTCATCGTTTACGGCGTGGACTACCAGGGTATCTAATCCTGTTTGCTCCCCACGCTTTCGCACCTCAGCGTCAGTAATGGACCAGTAAGCCGCCTTCGCCACTGGTGTTCCTCCGAATATCTACGAATTTCACCTCTACACTCGGAATTCCACTTACCTCTTCCATACTCAAGATACCCAGTATCAAAGGCAGTTCCGCAGTTGAGCTGCGGGATTTCACCCCTGACTTAAATATCCGCCTACGTGCGCTTTACGCCCAGTAATTCCGAACAACGCTAGCCCCCTTCGTATTACCGCGGCTGCTGGCACGAAGTTAGCCGGGGCTTCTTCTCCGACTACCGTCATTATCTTCATCGGTGAAAGAGCTTTACAACCCTAAGGCCTTCATCACTCACGCGGCATGGCTGGATCAGGCTTGCGCCCATTGTCCAATATTCCCCACTGCTGCCTCCCGTAGGAGTTTGGGCCGTGTCTCAGTCCCAATGTGGCTGATCATCCTCTCAGACCAGCTATGGATCGTCGCCTTGGTAGGCCTTTACCCCACCAACTAGCTAATCCA

JBA25-00101

$400.00Price