Product Name : JBA20-00601
Species name : Aspergillus sp. strain SS2/Aspergillus sp. strain KDT-2(100%)
Species/Strain : Species
Phylum : Ascomycota
Sequence :CCTTTTGATATGCTTAAGTTCAGCGGGTATCCCTACCTGATCCGAGGTCAACCTGGAAAAAGATTGATTTGCGTTCGGCAAGCGCCGGCCGGGCCTACAGAGCGGGTGACAAAGCCCCATACGCTCGAGGATCGGACGCGGTGCCGCCGCTGCCTTTGGGGCCCGTCCCCCCCGGAGAGGGGACGACGACCCAACACACAAGCCGTGCTTGATGGGCAGCAATGACGCTCGGACAGGCATGCCCCCCGGAATACCAGGGGGCGCAATGTGCGTTCAAAGACTCGATGATTCACGGAATTCTGCAATTCACACTAGTTATCGCATTTCGCTGCGTTCTTCATCGATGCCGGAACCAAGAGATCCATTGTTGAAAGTTTTAACTGATTGCGATACAATCAACTCAGACTTCACTAGATCAGACAGAGTTCGTGGTGTCTCCGGCGGGCGCGGGCCCGGGGCTGAGAGCCCCCGGCGGCCATGAATGGCGGGCCCGCCGAAGCAACTAAGGTACAGTAAACACGGGTGGGAGGTTGGGCTCGCTAGGAACCCTACACTCGGTAATGATCCTTCCGCAGGTTCACCTACGGAAACCTT

JBA20-00601

$400.00Price