Product Name : JBA20-00501
Species name : Aspergillus sydowii strain PZ07/ Aspergillus sydowii strain UTHSC 07-1018(99.09%)
Species/Strain : Species
Phylum : Ascomycota
Sequence :TCCTCTGATCGAGGTCACCTGAAGAAAAATGGTTGGAGACGTCGGCTGGCGCCCGGCCGGTCCTAGTCGAGCGGGTGACAAAGCCCCATACGCTCGAGGACCGGACACGGTGCCGCCGCTGCCTTTCGGGCCCGTCCCCCGGGGGGGACGACGACCCAACACACAAGCCGGGCTTGATGGGCAGCAATGACGCTCGGACAGGCATGCCCCCCGGAATGCCAGGGGGCGCAATGTGCGTTCAAAGACTCGATGATTCACTGAATTCTGCAATTCACATTACTTATCGCAGTTCGCTGCGTTCTTCATCGATGCCGGAACCAAGAGATCCATTGTTGAAAGTTTTGACTGATTTTATATTCAGACTCAGACTGCATCACTCTCAGGCATGAAGTTCAGTAGTCCCCGGCGGCTCGCCCCCGAGGGGGTTCCCCGCCGAAGCAACAGTGTTAGGTATTCACGGGTGGGAGGTTGGGCGCCCGGAGGCAGCCCGCACTCAGTAATGATCCTTCCGCAGGTTCACCTACGGAAACCTTGTTACNATTTTTTACTTCCA

JBA20-00501

$400.00Price