Product Name : JBA20-00101
Species name : Aspergillus fumigatus strain DYJ1(1)(99.68%)/Aspergillus fumigatus clone EF_542(99.36%)
Species/Strain : Species
Phylum : Ascomycota
Sequence :TTCCTCCCGGCTTTTGATATGCTTAAGTTCAGCGGGTATCCCTACCTGATCCGAGGTCAACCTTAGAAAAATAAAGTTGGGTGTCGGCTGGCGCCGGCCGGGCCTACAGAGCAGGTGACAAAGCCCCATACGCTCGAGGACCGGACGCGGTGCCGCCGCTGCCTTTCGGGCCCGTCCCCCGGGAGAGGGGGACGGGGGCCCAACACACAAGCCGTGCTTGAGGGCAGCAATGACGCTCGGACAGGCATGCCCCCCGGAATACCAGGGGGCGCAATGTGCGTTCAAAGACTCGATGATTCACTGAATTCTGCAATTCACATTACTTATCGCATTTCGCTGCGTTCTTCATCGATGCCGGAACCAAGAGATCCGTTGTTGAAAGTTTTAACTGATTACGATAATCAACTCAGACTGCATACTTTCAGAACAGCGTTCATGTTGGGGTCTTCGGCGGGCGCGGGCCCGGGGGCGCAAGGCCTCCCCGGCGGCCGTCGAAACGGCGGGCCCGCCGAAGCAACAAGGTACGATAGACACGGGTGGGAGGTTGGACCCAGAGGGCCCTCACTCGGTAATGATCCTTCCGCAGGTTCACCTACGGAAACCTTGTTACGATTTTTTTACTTCCA

JBA20-00101

$400.00Price