Product Name : JBA14-00101
Species name : Anaerococcus hydrogenalis strain JCM 7635 /Uncultured bacterium clone nbu189e01c1 (100%)
Species/Strain : Species
Phylum : Fermicutes
Sequence :GTCGAACGATGAAACTTAGATGATTTCTTCGGAATGAACTTAAGTGGATTAGTGGCGAACGGGTGAGTAACACGTGAGTAACCTGCCTTACACAAGGGGATAGCCTCTGGAAACGGAGAATAATACCCTATAAAGTCTAATCAGCCCATGCTGGAAAGACCAAAGATTTATCGGTGTAAGATGGACTTGCGTCTGATTAGCTAGTTGGTGAGATAAAAGCTCACCAAGGCGACGATCAGTAGCCGGCTTGAGAGAGTGTACGGCCACATTGGGACTGAGACACGGCCCAAACTCCTACGGGAGGCAGCAGTGGGGAATTTTGCACAATGGGGGAAACCCTGATGCAGCGACGCCGCGTGATTTAGAAGGCCTTCGGGTTGTAAAAATCTTTTTTACGGGATGAAAATGACAGTACCGTAAGAATAAGGTCCGGCTAAATACGTGCCAGCAGCCGCGGTAATACGTATGGACCGAGCGTTGTCCGGAATCATTGGGCGTAAAGGGTACGTAGGCGGCCTAGTAAGTTAGAAGTTAAAGAATATAGCTCAACTATATAAAGCTTTTAAAACTGCTAGGCTTGAGAGATGGAAGGGAAAGTGGAATTCCTAGTGTAGCGGTGAAATGCGCAGATATTAGGAAGAATACCGGTGGCGAAGGCGACTTTCTGGTCATCATCTGACGCTGAGGTAC

JBA14-00101

$400.00Price