Product Name : JBA10-00501
Species name : Alistipes timonensis JC136/Alistipes sp. CC-5826-wt-bac (99.28%)
Species/Strain : Species
Phylum : Bacteroidetes
Sequence :TACCGGATTTATTGGGTTTAAGGGTGCGTAGGCGGTTTGATAAGTTAGAGGTGAAATACCGGTGCTTAACACCGGAACTGCCTCTAATACTGTTGAGCTAGAGAGTAGTTGCGGTAGGCGGAATGTATGGTGTAGCGGTGAAATGCTTAGAGATCATACAGAACACCGATTGCGAAGGCAGCTTACCAAACTATATCTGACGTTGAGGCACGAAAGCGTGGGGAGCAAACAGGATTAGATACCCTGGTAGTCCACGCAGTAAACGATGATAACTCGCTGTCGGCGATACACAGTCGGTGGCTAAGCGAAAGCGATAAGTTATCCACCTGGGGAGTACGTTCGCAAGAATGAAACTCAAAGGAATTGACGGGGGCCCGCACAAGCGGAGGAACATGTGGTTTAATTCGATGATACGCGAGGAACCTTACCCGGGCTTGAAAGTTAGTGACGGATCTGGAAACAGGTCTTCCCTTCGGGGCACGAAACTAGGTGCTGCATGGTTGTCGTCAGCTCGTGCCGTGAGGTGTCGGGTTAAGTCCCACAACGCAGCCCAA

JBA10-00501

$400.00Price