Product Name : JBA10-00201
Species name : Alistipes indistinctus strain 4GAM-DE-D20-49/Alistipes indistinctus 2BBH45 DNA(100%)
Species/Strain : Species
Phylum : Bacteroidetes
Sequence :GCGTAGGCGGATTAGTAAGTTAGAGGTGAAAGCTCGATGCTCAACATCGAAATTGCCTCTGATACTGTTAGTCTAGAGTATAGTTGCGGAAGGCGGAATGTGTGGTGTAGCGGTGAAATGCTTAGATATCACACAGAACACCGATTGCGAAGGCAGCTTTCCAAGCTATTACTGACGCTGATGCACGAAAGCGTGGGGAGCGAACAGGATTAGATACCCTGGTAGTCCACGCCGTAAACGATGATAACTCGTTGCAGGCGATACACAGTCTGTGACTTAGCGAAAGCGTTAAGTTATCCACCTGGGGAGTACGTTCGCAAGAATGAAACTCAAAGGAATTGACGGGGGCCCGCACAAGCGGAGGAACATGTGGTTTAATTCGATGATACGCGAGGAACCTTACCCGGGCTTGAAAGTTAGCGACGGATCCTGAAAGGGGTCTTCTCTTCGGAGCGCGAAACTAGGTGCTGCATGGTTGTCGTCAGCTCGTGCCGTGAGGTGTCGGGTTAAGTCCCATAACGAGCGCAACCCA

JBA10-00201

$400.00Price