Product Name : JBA10-00101
Species name : Alistipes finegoldii strain DSM 17242/Alistipes finegoldii DSM 17242(97.31%)
Species/Strain : Species
Phylum : Bacteroidetes
Sequence :GATTCGGATTTATTGGGTTTAAGGGTGCGTAGGCGGTTTGATAAGTTAGAGGTGAAAGCTCGGGGCTCAACTCCGGAACTGCCTCTGATACTGTTGAACTAGAGAGTAGTTGCGGAAGGCGGAATGTGTGGTGTAGCGGTGAAATGCTTAGATATCATACAGAACACCGATTGCGAAGGCAGCTTACCAAACTATATCTGACGTTGATGCACGAAAGCGTGGGGAGCAAACAGGATTAGATACCCTGGTAGTCCACGCCGTAAACGATGATAACTCGTTGTCGGCGATACACAGTCTGTGACTAAGCGAAAGCGATAAGTTATCCACCTGGGGAGTACGTTCGCAAGAATGAAACTCAAAGGAATTGACGGGGGCCCGCACAAGCGGAGGAACATGTGGTTTAATTCGATGATACGCGAGGAACCTTACCCGGGCTTGAAAGTTAGTGACGATTCTGGAAACGGGACTTCCCTTCGGGGCACGAAACTAGGTGCTGCATGGTTGTCGTCAGCTCGTGCCGTGAGGTGTCGGGTTAAGTCCCACAACGAGCGCAACCCTT

JBA10-00101

$400.00Price